Biopython Seq and SeqRecord Objects

Hard rules

1. No fabricated citations. Every cited work must resolve to a verifiable
2. No claim without provenance. Every quantitative or factual claim
3. No silent failure. Every script invocation, API call, or tool use must declare its exit status and what to do on non-zero. A skill that silently swallows errors is a violation.

When to use

• Wrapping a plain Python string as a biological sequence.
• Slicing and indexing with biological semantics (.complement(), .reverse_complement()).
• Carrying per-record metadata: ID, description, annotations, features, dbxrefs.
• In-place edits via MutableSeq.

When NOT to use

• Plain string manipulation — use Python str. Seq is for biology.
• Massive-scale sequence ops → use pyfastx or parasail for kernels.
• File-level work → see ors-bioinformatics-sequence-read-write-sequences.

Prerequisites

• biopython>=1.83

Core workflow

1. Create a Seq from a string.
2. Index / slice like a string.
3. Wrap in a SeqRecord for I/O, feature handling, and metadata.
4. Mutate in place with MutableSeq only when you really need it.
5. Convert back to str only at the file boundary or the Bio.* API edge.

Code patterns

Construct a Seq

from Bio.Seq import Seq
"
s = Seq("ACGTACGT")
print(s.complement())         # TGCATGCA
print(s.reverse_complement()) # TACGTACG... actually ACGTACGT (palindrome in this case)

The IUPAC ambiguity alphabet (2026 reality)

Since Biopython 1.80, alphabet objects are deprecated. The new API is the Bio.Seq + Bio.SeqUtils functions, which assume IUPAC by default:

from Bio.Seq import Seq

s = Seq("ACGTNRYWSKMBDHV")     # 15 IUPAC codes
print(s.complement())           # full IUPAC complement table

If you're on older code that imports Bio.Alphabet, you'll see deprecation warnings. Migrate to:

# Old
from Bio.Alphabet import IUPAC
s = Seq("ACGT", IUPAC.unambiguous_dna)

# New
s = Seq("ACGT")  # assumed unambiguous DNA

MutableSeq — in-place editing

from Bio.Seq import MutableSeq

m = MutableSeq("ACGTACGT")
m[3] = "N"
print(m)        # ACGNACGT
m.reverse()
print(m)        # TGCANGCA

Convert back to immutable with:

s = m.toseq()

SeqRecord with metadata

from Bio.SeqRecord import SeqRecord
from Bio.Seq import Seq

rec = SeqRecord(
    Seq("ATGAAATAA"),
    id="seq1",
    name="seq1",
    description="example cDNA",
    annotations={"molecule_type": "mRNA", "organism": "Homo sapiens"},
    dbxrefs=["Project:PRJNA1"],
)

Add features to a SeqRecord

from Bio.SeqFeature import SeqFeature, FeatureLocation, BeforePosition, AfterPosition

cds = SeqFeature(
    location=FeatureLocation(0, 9, strand=1),
    type="CDS",
    qualifiers={"gene": ["ABC1"], "transl_table": [1]},
)
rec.features.append(cds)

Slicing semantics

s = Seq("ACGTACGT")
s[2:5]              # 'GTA'  (Seq, not str)
s[0:3:2]            # 'AG'   (step)
s[-3:]              # 'CGT'  (Seq, supports negative indexing)

Concatenation

Seq("ACGT") + Seq("AAAA")
# Seq('ACGTAAAA')

# Don't concat SeqRecord — use Biopython's `concat` carefully

Complement vs reverse-complement — the 5'/3' mental model

s = Seq("ATGC")
s.complement()            # TACG (still 5'→3' but antiparallel)
s.reverse_complement()    # GCAT (5'→3' of the opposite strand)

When in doubt about orientation, always use reverse_complement() to get back to "5' to 3' on the opposite strand". The plain .complement() keeps the original coordinate frame.

Translate, transcribe

coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
coding_dna.transcribe()           # mRNA (U for T)
coding_dna.translate()            # MAIVMGR* — uses table 1
coding_dna.translate(table="Vertebrate Mitochondrial")
coding_dna.translate(to_stop=True) # 'MAIVMGR'

Equality and hashing

Seq hashes to the same value as the underlying string. Two Seq("ACGT") from different alphabets compare equal in 1.83+.

Seq("ACGT") == "ACGT"   # True
hash(Seq("ACGT")) == hash("ACGT")  # True

Common pitfalls

• Seq is not a str in some methods. Some stdlib functions ("".join(...)) will reject it. Cast with str(s) when in doubt.
• Complement vs reverse-complement confusion. Use .reverse_complement() for mRNA/cDNA work, not .complement().
• Translating genomic DNA directly. Eukaryotic genes have introns — don't translate raw genomic DNA. Use feature.extract(rec.seq).translate() for CDS features.
• MutableSeq leaks. Convert back to Seq with m.toseq() before handing the object to a function that assumes immutability.
• In-place edits to a record's .seq don't update features. If you mutate the Seq, the feature coordinates may no longer match.

Validation

• len(rec.seq) == len(str(rec.seq)).
• record.seq == record.seq round-trip identity.
• After MutableSeq → Seq, the new Seq is truly immutable (you can't assign s[0] = "A").

Open alternatives

References

• Biopython Seq tutorial: https://biopython.org/docs/latest/Tutorial.html#chapter3
• IUPAC codes: https://www.bioinformatics.org/sms/iupac.html
• Companion: ors-bioinformatics-sequence-reverse-complement, ors-bioinformatics-sequence-transcription-translation.

Changelog

• 1.0.0 (2026-06-10): Initial adaptation by Pradyumna Jayaram from bio-seq-objects (bioSkills-main/sequence-manipulation/seq-objects).

Cross-references

Other skills in this category:

• batch-processing
• bowtie2-alignment
• bwa-alignment
• bwa-mem2-alignment
• codon-usage
• compressed-sequence-files
• fastq-quality-scores
• filter-sequences
• format-conversion
• hisat2-alignment
• motif-search
• paired-end-fastq
• pysam-genomics
• read-write-sequences
• reverse-complement
• sam-bam-basics
• samtools-bam-processing
• sequence-properties
• sequence-slicing
• sequence-statistics
• star-alignment
• transcription-translation